Human Genetic Variation - SNPs and Haplotypes
Purpose: to learn about SNPs, how SNP clusters form haplotypes, and how SNPs and haplotypes can be identified.
SNPs are formed through changes in single nucleotides. Two principally different processes can cause these changes: the exchange of one nucleotide for another, or the chemical transformation of one nucleotide into another. Depending on the kind of exchange chemical transformations are either transitions or transversions. Transitions are replacements of purines against other purines (A <-> G) or of pyrimidines against other pyrimidines (C <-> T). Transversions are exchanges of purines against pyrimidines and vice versa. Transitions have been found to be more frequent than transversions.

Any of the four different nucleotides can be in any of the (roughly) 3.2 billion positions in the human genome. Thus, SNPs can have four possible alleles: A, C, T, or G. However, SNPs with two alleles have been found much more frequently than SNPs with three or four different alleles; the ratios are roughly 20-30% for two alleles, 0.5% for three alleles, and 0.005% for four different alleles. Again, A/G and C/T alleles are more frequent than A/C, or G/T alleles.
How would you go about indentifying SNPs in these six sequences?
    1. agctggctgaatgctatctgcgtcgcgcgaaataaacgtcagcattcgttacatctctctagggc
    2. agctggctgaatgctatctgcctcgcgcgaaataaacgtcagcattcgttacatttctctagggc
    3. agctggctgaatgctatctgcgtcgcgcgaaacaaacgtcagcattcgttacatttctctagggc
    4. agctggctgaatgctatctgcgtcgcgcgaaataaacgtcagcattcgttacatttctctagggc
    5. agctggctgagtgctatctgcctcgcgcgaaataaacgtcagcattcgttacatttctctagggc
    6. agctggctgaatgctatctgcgtcgcgcgaaataaacgtcagcgttcgttacatctctctagggc

  1. You could use paper and pencil and pairwise compare all sequences to identify the differences.


  2. You could also use a computer program that performs multiple sequence alignments, such as ClustalW to do the job for you.


  3. Enter Sequence Server, open 'Manage Groups', select 'Public', and 'SNPs'


  4. Check all six sequences and launch 'ClustalW'.


  5. Which differences can you identify?

  6. Are there sequences that have more than one difference if compared to others?


  7. Identify the transitions and the transversions in these sequences.
Haplotypes are clusters of SNPs. The SNPs in the exercise above occur embedded in a background of identical nucleotides. Each of the six sequences is a cluster of nucleotides that contains a cluster of SNPs. Write out the six different haplotypes for the six sequences above. (Haplotypes list only the differences and neglect the nucleotides which are identical among these sequences compared.