SNPs
Variations on the Human Genome - Exercises

The sequencing of the human genome has lead to the discovery of a bounty of SNPs; on average, two equivalent human chromosomes entail one SNP per 1300 nucleotides. Several research institutions are involved in SNP discovery, the most prominent of which is The SNP Consortium. The SNP Consortium consists of several corporations vested in pharmacy as well as in informatics, and four major academic centers for molecular genetics and genomics (see http://snp.cshl.org/about/).

SNP Exploration

The following exercises will familiarize you with SNPs, SNP phylogeny, and the SNP database of The SNP consortium.

• Determine the differences between the following six sequences utilizing Sequence Server:
  
  
  1. agctggctgaatgctatctgcgtcgcgcgaaataaacgtcagcattcgttacatctctctagggc
  2. agctggctgaatgctatctgcctcgcgcgaaataaacgtcagcattcgttacatttctctagggc
  3. agctggctgaatgctatctgcgtcgcgcgaaacaaacgtcagcattcgttacatttctctagggc
  4. agctggctgaatgctatctgcgtcgcgcgaaataaacgtcagcattcgttacatttctctagggc
  5. agctggctgagtgctatctgcctcgcgcgaaataaacgtcagcattcgttacatttctctagggc
  6. agctggctgaatgctatctgcgtcgcgcgaaataaacgtcagcgttcgttacatctctctagggc
  
  
• Haplotypes are groups of SNPs that occur linked together in an allele. Determine how the following six haplotypes could be derived from each other. Draw a phylogenetic tree, assuming that at each branching point only one nucleotide is being altered. Thus, fromout each branching point two lineages proceed: one carrying the parental haplotype and one carrying the haplotype that contains a change in one nucleotide position.
  
  
  1. --A--G--T--A--C--
  2. --A--C--T--A--T--
  3. --A--G--C--A--T--
  4. --A--G--T--A--T--
  5. --G--C--T--A--T--
  6. --A--G--T--G--C--



• The SNP Consortium Database at Cold Spring Harbor Laboratory contains roughly 1.5 million entries. This file is to big to download so, please, don't try it on a course computer!!!!
However, you can view the content of the CSHL SNP database here.


• In order to develop an understanding of the nature of the SNP database it is sufficient to look into small excerpts of the entire database. Below find a number of smaller packages derived from the entire database.




Select a package and analyze its content. select package package 01 package 02 package 03 package 04 package 05 package 06 package 07 package 08 package 09 package 10 package 11 package 12 package 13 package 14 package 15 package 16 package 17 package 18 package 19 package 20 package 21 package 22 package 23 package 24 package 25 package 26 package 27 package 28 package 29 package 30 How many SNPs does your database excerpt list? How many the entire database? (Hint: look at the last package in the list to answer this question) What entries (columns) are provided for each SNP? Select a few SNPs and list their genotypes. (hint: use the GenBank accession in the databank to find out what chromosome the SNPs are located on). List the different polymorphisms in your package. Which combinations did you find? In what percentages do the different polymorphisms occur in your package? List reasons that may lead to the great variation in frequencies. Hint: think about how the different alleles that have been found for a single locus may have been derived from each other. (Hint: examine the structures of the four different nucleotides in this listing, this website or this image)

• Now analyze the entire database! Just kidding! Just kidding! But look at it, anyway.


1. Can you think of a computer program that would have made the previous tasks easier? What features would this program have to entail? How about a program that would allow you to answer the following questions and still be home in time for dinner?
2. One possible computer program can be viewed here. Please have a look at it and try to recognize some of the processes that you utilized during your manual analysis.
3. Applying the program, how many different polymorphisms can you identify in the entire database?
4. List all possible different allele combinations.
5. Determine the ratios for the occurence of different polymorphisms in the entire database?
6. Compare and contrast your results with your previous findings. Why does the databank contain a different number of SNPs than you had estimated previously (question 1) above)

• Go to SNP Consortium
• Check out 'About'
• Find SNPs in and/or adjacent to Human Cadherin Gene (Heart)
• 'About'; 'Gene Search'; type in search string; 'Search'; check respective box; 'Dump table'; view results
• Find genes around particular SNP
• Choose a SNP ID; open Blast Genome Search; perform search
• Record Request ID for back later; 'Format'
• In result window select 'Genome View'
• Select record for 'Map element'
• Make sense of result
• Identify SNPs in your sequence
• 'About'; 'Blast'; Paste in sequence
• Select 'View features in this region'
• How many SNPs were identified in your sequence?

• Go to http://www.ensembl.org/
• Explore the 'How do I ...?' section
• Select a chromosome under 'Browse a Chromosome' (e.g. Girls go to Y and guys to X)
• Examine the sequence visually and discuss whether SNPs appear to be randomly distributed over the genome or not
• Run cursor over the different feature bars and larn how to navigate the display by utilizing the information provided in the pop-up windows, especially the function that lets you zoom in
• Can you identify a correlation between occurence of SNPs and GC content and prevalence of CpG islands?
• Do SNPs appear to more prevalent in genes or in intergenic regions?
• Examine 10 intergenic and 10 intragenic SNPs in more detail. What alleles can you identify for each SNP? (Make sure that you record the exact location of each SNP, so that you can find it back after you closed the image)
• Select a region that you want look further into and zoom into the image until you can identify the nucleotide sequence for this region

Follow this link to Chapter 2: SNPs in Biomedicine