Description:
Determine the sequence of DNA.
Transcript:
HI!
Your sister is a molecular biology graduate student. She invited you to visit her lab.
Before she could give you a tour, her supervisor called a quick lab meeting. You're now sitting at her desk waiting for her to come back.
Your sister has been trying to sequence a gene, and the autoradiogram of the sequencing gel is on her desk. You're going to read the sequence.
From bottom to top, starting at the A, what is the sequence of the first 20 nucleotides?
CTGCTGATGTTGAATTAGAG (No, the sequence starts with A.)
ACTGCTGATGTTGAATTAGA (That is correct.)
ACGTACGTACGTACGTACGT (No, these are just the four nucleotides repeated.)
GACTAGTGCTCCTGGCCGTG (No, this is not correct.)
You read as much of the sequence as you can and write the sequence down in your sister's notebook.
Assuming that the DNA strand you just read is the 5' to 3' strand, what is the complement DNA sequence? Start with the 3' end of the DNA complement.
3'ACTGCTGATGTTGAATTAGA 5' (No, this is the 5' to 3' DNA sequence.)
3'ACUGCUGAUGUUGAAUUAGA 5' (No, this is an mRNA sequence.)
3'UGACGACUACAACUUAAUCU 5' (No, this is an mRNA sequence.)
3'TGACGACTACAACTTAATCT 5' (That is correct.)
Adenine bonds with thymine; guanine bonds with cytosine. This is the complement DNA sequence.
RNA polymerase reads the 3' to 5' DNA sequence to make mRNA. What is the mRNA sequence made in this example?
5'ACTGCTGATGTTGAATTAGA 3' (No, this is 3' to 5' DNA sequence.)
5'ACUGCUGAUGUUGAAUUAGA 3' (That is correct.)
5'UGACGACUACAACUUAAUCU 3' (No, this is not the correct mRNA sequence.)
5'TGACGACTACAACTTAATCT 3' (No, this is 3' to 5' DNA sequence.)
mRNA has uracils instead of thymine. Notice that the mRNA is the same as the 5' to 3' DNA sequence with uracils replacing thymines.
Your sister probably uses a computer program to decode the mRNA, but it's a short sequence so you use a codon table. What will the first 20 nucleotides of this mRNA sequence code for? Use as the stop codon.
T A D V E L (Yes, if the ribosomes start with ACU codon; how do you know it starts here?)
L L M L N* (Yes, if the ribosomes start with CUG codon; how do you know it starts here?)
C C I R (Yes, if the ribosomes start with UGC codon; how do you know it starts here?)
All of the above. (That is correct.)
None of the above. (No, theoretically this mRNA can code for something.)
Since you don't know where the gene starts, you have to consider all three frames of the sequence.
You realize that you don't know how your sister got this sequence, so you really have to consider all six frames. After all, RNA polymerase may be reading the other strand for the "gene." What is the other mRNA that could be made?
5'UUAACGCGUGCCUCUGGUCU 3' (That is correct.)
5'TTAACGCGTGCCTCTGGTCT 3' (No, this is DNA sequence.)
5'TGACGACTACAACTTAATCT 3' (No, this is the DNA sequence in the wrong orientation.)
The "other" mRNA sequence reads like the complement DNA with uracils replacing thymines.
You deduce the codons for the other mRNA sequence.
5'UUAACGCGUGCCUCUGGUCUAGCAGCCGC
Based on what you know, which, if any, of these frames should your sister investigate first as being part of a gene?
Frames 1, 2, 3 (No, frames 2 and 3 have stop codons and probably don't code for a protein.)
Frames 2, 4, 5 (No, frame 2 has a stop codon and probably doesn't code for a protein.)
Frames 1, 3, 5 (No, frame 3 has stop codons and probably doesn't code for a protein.)
Frames 1, 4, 6 (That is correct.)
Frame 1 (Yes, frame 1 is a possibility, but not the only one.)
Frame 5 (Yes, frame 5 is a possibility, but not the only one.0
None of the above. (No, there are frames that may code for protein.)
Frames 2, 3 and 5 are less likely candidates as genes because of the stop codons in the protein sequence. Frames 1, 4 and 6 are the good candidates as possible genes.
CONGRATULATIONS!!!
YOU'RE SO SMART!
Keywords:
rna polymerase, dna strand, mrna sequence, codon table, autoradiogram, complement dna
Downloads: